Skip to content Skip to sidebar Skip to footer

Blood Culturebased Diagnosis of Bacteraemia State of the Art

INTRODUCTION

Bloodstream infections (BSIs) cause significant global morbidity and bloodshed.1 Bloodstream infections are confirmed through performing broth civilization of a patient's blood for 5–7 days to discover bacteremia. This is regarded as the gold standard,2,three and allows pathogen identification and susceptibility testing to guide treatment. Withal, claret cultures are often negative. In the Lao Peoples' Democratic Republic (Lao PDR), one prospective series establish 16.seven% of blood cultures from inpatients were positive, yet but 10.eight% were clinically relevant (the remainder is likely positive because of contagion).four The main reasons for negativity may exist that the patients had non-bacteremic illness or bacteria were present intermittently or at very low blood density. Nonetheless, an boosted explanation is that the causative microorganisms are delicate, fastidious, nonviable, irksome growing at depression densities, or uncultivable in blood civilization medium. This is often seen with bacteria such equally Streptococcus pneumoniae, Leptospira spp., Rickettsia spp., and Orientia spp.,five,6 or when antimicrobial treatment has been started before blood drove, which may kill or inhibit pathogen growth.3 These diagnoses may therefore exist missed and may be referred to as "false negatives." Timely, appropriate, and targeted antimicrobial treatment is imperative to ensure patient survival in suspected BSI,vii so at that place is a need to minimize and identify imitation negatives early. Previous studies accept looked at specifically detecting Orientia tsutsugamushi, Rickettsia spp., and Leptospira spp. in hemoculture fluid to evaluate culling methods of diagnosis, proving somewhat successful for O. tsutsugamushi and Leptospira spp. but not for Rickettsia spp.,eight,9 merely no full general evaluation of a broader range of bacteria was conducted. We investigated 5-24-hour interval negative blood cultures for the presence of bacterial pathogens using polymerase chain reaction (PCR).

MATERIALS AND METHODS

Ethical approving for use of blood samples was granted past the Oxford Tropical Research Ideals Commission, the Academy of Oxford (Oxford, United Kingdom), and the National Ethics Commission for Health Research, Lao PDR. Study patients provided written informed consent. The written report was conducted between June and July 2019. Blood cultures from patients suspected of having a systemic infection were processed routinely at Mahosot Hospital Microbiology Laboratory, Vientiane, Lao PDR. Samples collected in BD BACTEC Plus Aerobic/F culture vials (Becton Dickinson, Franklin Lakes, NJ) were incubated using the BACTEC (Becton Dickinson, New Jersey) system and reported as negative subsequently v days. Negative claret cultures were randomly selected from discarded culture bottles for further testing, with the only pick criterion existence samples from adults (≥ 15 years onetime). Dna extraction was performed on 0.5 mL of blood culture fluid using QIAamp DNA Mini Kit (Qiagen, Manchester, United kingdom of great britain and northern ireland) according to Method five by Villumsen et al. ten Both broad and genus- or species-specific PCRs were performed (Table 1). PCR selections were based on common endemic organisms in the region. Quantitative PCRs (qPCRs) targeting Rickettsia spp. 17-kDa,11 Rickettsia typhi ompB,12 and Leptospira spp. rrs gene13 were performed on CFX96 Real-Time System (Bio-Rad, Bangkok, Thailand). Conventional PCRs (cPCRs) targeting O. tsutsugamushi 56-kDa gene14 and pan-bacterial 16S rRNAxv were performed on a C1000 Touch Thermal Cycler (Bio-Rad, Thailand); products were visualized on a i% agarose gel. PCR products from 16S rRNA-positive samples were sent for sequencing (Macrogen, Seoul, Republic of korea), and resulting sequences were compared against GenBank via BLASTn submission (https://smash.ncbi.nlm.nih.gov). Patient records were checked, and along with other laboratory results (including PCR results for rickettsial organisms from ethylenediaminetetraacetic (EDTA) buffy coat, and Leptospira spp., dengue virus and Zika virus from serumxi,xiii,16,17), discharge diagnosis and antimicrobial usage were linked to PCR results.

Table 1

Details of PCRs performed

Pathogen Name Sequence 5′-3′ Primer/Probe Target region Ref
Orientia tsutsugamushi 56 kDa-RTS-8 AGGATTAGAGTGTGGTCCTT Frontwards 56-kDa outer membrane poly peptide (omp) (fourteen)
56 kDa-RTS-9 ACAGATGCACTATTAGGCAA Reverse
Rickettsia spp. R17K128F2 GGGCGGTATGAAYAAACAAG Forward 17-kDa surface antigen (eleven)
R17K238R CCTACACCTACTCCVACAAG Opposite
R17K202TAQP FAM-CCGAATTGAGAACCAAGTAATGC-TAMRA Probe
Rickettsia typhi Rt557F TGGTATTACTGCTCAACAAGCT Forrad ompB (12)
Rt678R CAGTAAAGTCTATTGATCCTACACC Reverse
Rt640BP FAM-CGCGATCGTTAATAGCAGCACCAGCATTATCGCG-BHQ1 Probe
Leptospira spp. Lepto-F CCCGCGTCCGATTAG Forrad rrs gene (thirteen)
Lepto-R TCCATTGTGGCCGRACAC Opposite
Lepto-probe half dozen-FAM-CTCACCAAGGCGACGATCGGTAGC-BHQ1 Probe
Pan-bacterial 27F/V1-F AGAGTTTGATCMTGGCTCAG Frontward 16S rRNA (15)
518R/V3-R GTATTACCGCGGCTGCTGGCA Opposite

RESULTS

1-hundred ninety, twenty-four hour period-5 negative blood civilisation samples were studied from 189 patients. Of these, 53 (27.ix%) were positive past PCR for bacterial Deoxyribonucleic acid. Twelve (6.3%) were positive for Rickettsia spp. (qPCR quantification cycle [Cq] = 34.5–38.v), of which 2 samples were further identified as R. typhi (Cq = 30.8–36.8). Ane sample (0.5%) was positive for Leptospira sp. (Cq = 34.1). Pan-bacterial 16S rRNA cPCR gave 41 (21.6%) positives; of these, thirty PCR products were suitable for sequencing. Escherichia coli was identified in xi samples (identity 100%), Klebsiella pneumoniae in eight (99–100%), Rheinheimera spp. in five (99–100%), Pantoea vagans in ii (99–100%), 1 sample was identified as Erwinia gerundensis (100%), one as Plesiomonas shigelloides (100%), and one as a Yersinia sp. (99%) (Effigy one). One sample was suspected to be a polymicrobial infection from mixed sequencing results. One sample was positive for both Rickettsia spp. and Yard. pneumoniae. Orientia tsutsugamushi was non detected. Where a genus- or species-specific identification was made, 34 were classed every bit "potentially clinically significant," five as "not significant," and ii of "uncertain clinical significance" (see Figure 1). PCR of buffy glaze samples for rickettsial pathogens and Leptospira PCR (on serum) was only requested in i patient, who was negative (the blood culture fluid was as well negative for whatever bacteria for this patient). Dengue investigations were requested for 112 of the patients in this series; 90 were positive for dengue virus RNA in serum (90/112, 80.4%), of whom 23 (25.6%) besides had a positive bacterial PCR from the negative blood culture fluid. Bacteria identified in dengue-positive patients include Rickettsia spp. (21.7%), Leptospira spp. (iv.3%), Eastward. gerundensis (iv.3%), K. pneumoniae (21.7%), Eastward. coli (26.1%), and P. shigelloides (4.3%). Of the five Rickettsia spp. positives who were too positive for dengue, ane patient had an admission diagnosis of "Rickettsial illness/dengue without alarm signs." However, the odds ratio (OR) of the likelihood of association between PCR-positive blood culture and the presence of dengue infection was non statistically significant (OR: 1.46; 95% CI: 0.41–6.55; P = 0.778). Of 111 patients also tested for Zika virus, all were negative, and patients were not screened for Chikungunya virus. Vientiane is not a malaria-endemic region. Co-ordinate to patient records, four (vii.5%) PCR-positive patients had taken ceftriaxone before sampling (organisms identified included Rickettsia sp., Eastward. coli, and P. vagans) and fifteen (28.3%) had not taken antimicrobials, and for 34 (64.two%) patients, this was unknown. Merely two patients (1 Leptospira sp.–positive and one Rickettsia sp.–positive) received doxycycline. No other Rickettsia spp.–positive patients received a tetracycline.

Figure 1.

Effigy 1.

Numbers of organisms identified past genus- and species-specific PCRs, 16S rRNA PCR, and sequencing (including percent identity match), n = 53.

a Identification by genus- and species-specific PCRs.

b 16S rRNA PCR-positive, but no genus or species identification could be made.

c Percent identity match by sequencing of 16S rRNA PCR product. due north/a = not applicable, samples were identified past genus- or species-specific PCRs, not 16S rRNA and were not subjected to Nail assay.

Commendation: The American Periodical of Tropical Medicine and Hygiene 104, four; 10.4269/ajtmh.20-1348

  • Download Effigy

Where available, patient records were reviewed to evaluate if the patient management, diagnosis, or effect would have been influenced or inverse past the PCR effect (presence/absence of leaner) or species identification. The positive 16S PCR outcome would probably have influenced patient direction considerations (i.e., the attention clinician would have checked current specific direction or considered possible changes to management) in all 53 patients (100%), whether or non a specific species identification had been made. Where patient management data was available, the majority of patients (55.8%, 24/43) would likely have had a change in management (i.e., given antibiotics when they originally did not receive whatsoever, or had a change in antibiotic class given). In particular, three patients identified as Rickettsia sp. positive had not been given a tetracycline; if these data had been available during patient access, they would have had a change in management. Where a genus- or species-specific identification was fabricated, direction would likely have been influenced in ninety.2% (37/41) of patients, and management likely have been inverse in 69.seven% (23/33) of patients. The identification of whatever bacteria present would have likely changed the concluding diagnosis in 55.eight% (24/43) of patients: 90.ix% (30/33) when a genus- or species-specific identification was made. Overall, a review of patient outcomes suggested that a positive 16S rRNA cPCR consequence would have inverse the outcome in only one patient (2.3%, north = 43), and a genus- or species-specific identification in ii patients (half-dozen.one%, n = 33).

DISCUSSION

Potential bacterial pathogens were successfully identified past PCR in over 25% of claret cultures that had been reported equally negative after 5 days; over 5% contained rickettsial DNA. However, this must be interpreted with caution, given the high incidence of acute dengue in this series. Any bacterial organism cultured from a sterile site (such as claret) is a potential pathogen, although in the Lao PDR, contaminants such every bit coagulase-negative staphylococci are frequently isolated from positive blood cultures.4 For samples containing E. coli, K. pneumoniae, R. typhi, or Leptospira spp. DNA, the findings were considered potentially clinically significant. These leaner are unlikely contaminants, and about patients will develop febrile illnesses inside days of infection.xviii,nineteen Escherichia coli and K. pneumoniae grow readily in blood culture media, are mutual isolates from blood cultures,20 and have the potential to cause serious illness.21 That these pathogens did not abound in these bottles, leading to a false negative, could be due to several reasons, such as organism death or growth inhibition from incorrect sample handling or prior antimicrobial handling, very depression circulating bacterial loads, or transient DNAemia (e.grand., secondary to dengue infection). Although plausible, inappropriate handling of samples, such equally storage conditions of inoculated bottles before blood culture,22 is an unlikely reason for a negative blood culture in this report equally the fourth dimension between sample collection and inoculating blood culture bottles is generally curt in Mahosot Hospital (bottles are inoculated at the bed-side and transferred to the laboratory inside a few hours). The employ of wrong blood volumes for inoculating claret culture bottles may also exist discounted every bit the mean blood volume used was not statistically significant between PCR-positive (mean: ten.15 mL; IQR: 9.68–ten.62 mL) and PCR-negative (mean: 9.84 mL; IQR: 9.39–ten.29 mL) blood cultures (P = 0.434). A more than likely reason is a low bacterial inoculum (assuming the initial presence of viable organisms) due to antimicrobial treatment before blood culture, with the selective pressure of antimicrobials suppressing bacterial growth.23 Only 7.5% of the PCR-positive patients reported taking antimicrobials before sampling. However, given the widespread practice of self-medication with antimicrobials in the Lao PDR and ready availability of over-the-counter antimicrobials, many patients are probable to have self-treated.24,25 Patient records indicated that 25 of the PCR-positive patients had other samples taken for culture (other blood cultures, pus, urine, stool, and cerebrospinal fluid). Of these, seven patients (28%) had positive cultures. One patient whose blood culture was PCR positive for Klebsiella pneumonia also had Grand. pneumoniae identified from ii blood cultures taken within the previous half-dozen months. At that place were no other bacterial Dna PCR-positive samples which grew the same bacteria from a previous blood culture.

Although it has been shown that leptospires and rickettsial organisms such every bit O. tsutsugamushi remain viable in claret cultureeight,nine,26 and may even benefit diagnosis through enhancement of organism numbers, standard blood culture detection systems are unable to reveal their presence. This study has confirmed those findings, with the detection of both Leptospira spp. and Rickettsia spp., including R. typhi past PCR. Our results suggest that routine PCR of negative claret cultures for these organisms might be valuable in some settings.

Patients in this study had blood cultures nerveless because they displayed symptoms/signs of BSI. Notwithstanding, the human relationship betwixt the finding of bacterial DNA and the clinical manifestations cannot be proven—it could exist casual and not causative. Not all patients in the study may accept been genuinely bacteremic, and some of the bacterial species identified are of uncertain or doubtful clinical significance, such every bit Rheinheimera spp. The clinical manifestations observed in patients could be due to other non-BSI etiologies (in many cases, this may have been due to dengue) because BSI symptoms are mostly nonspecific. For patients with a PCR-positive but blood culture-negative result, interpretation has to be carried out together with the analysis of patient's clinical records to determine its clinical significance. In addition, these so-chosen false negatives may not be clinically pregnant if the bacteria detected are too low in concentration to cause affliction, such as a self-limiting transient infection.3 That said, clinical review suggests that a positive PCR from negative hemoculture fluids would have influenced patient direction in all 53 patients, and in 90.2% of cases when a genus or species identification was made. In addition, between 55.8% and 69.7% of patients would probably have had a modify in clinical direction, although but 2.3–6.i% of patients would likely have had an altered terminal effect.

The finding of Rickettsia spp. and Leptospira spp. DNA in negative blood culture affirms the potential of this technique to observe such fastidious bacteria.8,nine,25 The detection of Enterobacteriaceae, such as E. coli and K. pneumoniae, in negative blood cultures shows that a multipronged approach may improve diagnosis, even for bacteria normally considered fast growing in broth media.

These findings warrant further study (with comparing of patients who are dengue PCR positive and negative) and give-and-take, peculiarly over routine employ and timing of PCR for organisms such equally Rickettsia and Leptospira, which are of import pathogens in Southeast Asia, and the role of dengue in bacterial infections. This will inevitably involve balancing clinical, financial, and logistical considerations, especially in low-resource settings such as the Lao PDR.

ACKNOWLEDGMENTS

We would like to give thanks the directors and medical staff of Mahosot Hospital, and the staff of the Microbiology Laboratory and infirmary wards for their support. We also thank Elizabeth Ashley for constructive comments.

REFERENCES

  • 1.↑

    Rudd KE et al. 2020 . Global, regional, and national sepsis incidence and mortality, 1990–2017: analysis for the Global Burden of Disease Study . Lancet 395 : 200 – 211 .

      Rudd KE 2020. Global, regional, and national sepsis incidence and mortality, 1990–2017: analysis for the Global Burden of Disease Study. Lancet395: 200–211.

      )| faux

    • Search Google Scholar
    • Export Citation
  • two.↑

    Lamy B , Dargere Southward , Arendrup MC , Parienti JJ , Tattevin P , 2016 . How to optimize the apply of blood cultures for the diagnosis of bloodstream infections? A country-of-the fine art . Front end Microbiol seven : 697 .

      Lamy B Dargere S Arendrup MC Parienti JJ Tattevin P , 2016. How to optimize the use of blood cultures for the diagnosis of bloodstream infections? A land-of-the fine art. Front Microbiol7: 697.

      )| imitation

    • Search Google Scholar
    • Export Citation
  • 3.↑

    Opota O , Jaton K , Greub 1000 , 2015 . Microbial diagnosis of bloodstream infection: towards molecular diagnosis directly from claret . Clin Microbiol Infect 21 : 323 – 331 .

      Opota O Jaton 1000 Greub G , 2015. Microbial diagnosis of bloodstream infection: towards molecular diagnosis directly from blood. Clin Microbiol Infect21: 323–331.

      )| false

    • Search Google Scholar
    • Export Citation
  • 4.↑

    Phetsouvanh R et al. 2006 . Causes of community-acquired bacteremia and patterns of antimicrobial resistance in Vientiane, Laos . Am J Trop Med Hyg 75 : 978 – 985 .

      Phetsouvanh R 2006. Causes of customs-acquired bacteremia and patterns of antimicrobial resistance in Vientiane, Laos. Am J Trop Med Hyg75: 978–985.

      )| false

    • Search Google Scholar
    • Export Citation
  • v.↑

    Fischer GW , Longfield R , Hemming VG , Valdes-Dapena A , Smith LP , 1982 . Pneumococcal sepsis with false-negative blood cultures . Am J Clin Pathol 78 : 348 – 350 .

      Fischer GW Longfield R Hemming VG Valdes-Dapena A Smith LP , 1982. Pneumococcal sepsis with faux-negative blood cultures. Am J Clin Pathol78: 348–350.

      )| false

    • Search Google Scholar
    • Consign Commendation
  • half-dozen.↑

    Chideroli RT , Goncalves DD , Suphoronski SA , Alfieri AF , Alfieri AA , de Oliveira AG , de Freitas JC , Pereira UP , 2017 . Culture strategies for isolation of captious Leptospira serovar Hardjo and molecular differentiation of genotypes Hardjobovis and Hardjoprajitno . Front Microbiol 8 : 2155 .

      Chideroli RT Goncalves DD Suphoronski SA Alfieri AF Alfieri AA de Oliveira AG de Freitas JC Pereira UP , 2017. Civilization strategies for isolation of fastidious Leptospira serovar Hardjo and molecular differentiation of genotypes Hardjobovis and Hardjoprajitno. Front Microbiol8: 2155.

      )| false

    • Search Google Scholar
    • Export Citation
  • 7.↑

    Kirn TJ , Weinstein MP , 2013 . Update on blood cultures: how to obtain, process, study, and interpret . Clin Microbiol Infect nineteen : 513 – 520 .

      Kirn TJ Weinstein MP , 2013. Update on claret cultures: how to obtain, process, report, and interpret. Clin Microbiol Infectxix: 513–520.

      )| false

    • Search Google Scholar
    • Export Citation
  • 8.↑

    Dittrich Due south et al. 2016 . Survival and growth of Orientia tsutsugamushi in conventional hemocultures . Emerg Infect Dis 22 : 1460 – 1463 .

      Dittrich Southward 2016. Survival and growth of Orientia tsutsugamushi in conventional hemocultures. Emerg Infect Dis22: 1460–1463.

      )| false

    • Search Google Scholar
    • Export Citation
  • ix.↑

    Dittrich South et al. 2016 . The utility of blood culture fluid for the molecular diagnosis of Leptospira : a prospective evaluation . Am J Trop Med Hyg 94 : 736 – 740 .

      Dittrich S 2016. The utility of blood civilisation fluid for the molecular diagnosis of Leptospira: a prospective evaluation. Am J Trop Med Hyg94: 736–740.

      )| false

    • Search Google Scholar
    • Consign Commendation
  • 10.↑

    Villumsen S , Pedersen R , Krogfelt KA , Jensen JS , 2010 . Expanding the diagnostic employ of PCR in leptospirosis: improved method for Deoxyribonucleic acid extraction from blood cultures . PLoS One 5 : e12095 .

      Villumsen S Pedersen R Krogfelt KA Jensen JS , 2010. Expanding the diagnostic use of PCR in leptospirosis: improved method for DNA extraction from blood cultures. PLoS Onev: e12095.

      )| simulated

    • Search Google Scholar
    • Export Citation
  • 11.↑

    Jiang J , Chan TC , Temenak JJ , Dasch GA , Ching WM , Richards AL , 2004 . Development of a quantitative real-time polymerase chain reaction assay specific for Orientia tsutsugamushi . Am J Trop Med Hyg seventy : 351 – 356 .

      Jiang J Chan TC Temenak JJ Dasch GA Ching WM Richards AL , 2004. Development of a quantitative existent-time polymerase chain reaction assay specific for Orientia tsutsugamushi . Am J Trop Med Hyg70: 351–356.

      )| false

    • Search Google Scholar
    • Export Citation
  • 12.↑

    Henry KM , Jiang J , Rozmajzl PJ , Azad AF , Macaluso KR , Richards AL , 2007 . Evolution of quantitative existent-time PCR assays to detect Rickettsia typhi and Rickettsia felis , the causative agents of murine typhus and flea-borne spotted fever . Mol Prison cell Probes 21 : 17 – 23 .

      Henry KM Jiang J Rozmajzl PJ Azad AF Macaluso KR Richards AL , 2007. Evolution of quantitative real-time PCR assays to detect Rickettsia typhi and Rickettsia felis, the causative agents of murine typhus and flea-borne spotted fever. Mol Cell Probes21: 17–23.

      )| false

    • Search Google Scholar
    • Export Citation
  • 13.↑

    Smythe LD , Smith IL , Smith GA , Dohnt MF , Symonds ML , Barnett LJ , McKay DB , 2002 . A quantitative PCR (TaqMan) assay for pathogenic Leptospira spp . BMC Infect Dis 2 : xiii .

      Smythe LD Smith IL Smith GA Dohnt MF Symonds ML Barnett LJ McKay DB , 2002. A quantitative PCR (TaqMan) assay for pathogenic Leptospira spp. BMC Infect Disii: 13.

      )| simulated

    • Search Google Scholar
    • Export Citation
  • 14.↑

    Horinouchi H , Murai One thousand , Okayama A , Nagatomo Y , Tachibana Northward , Tsubouchi H , 1996 . Genotypic identification of Rickettsia tsutsugamushi by restriction fragment length polymorphism analysis of DNA amplified by the polymerase chain reaction . Am J Trop Med Hyg 54 : 647 – 651 .

      Horinouchi H Murai Yard Okayama A Nagatomo Y Tachibana N Tsubouchi H , 1996. Genotypic identification of Rickettsia tsutsugamushi by restriction fragment length polymorphism analysis of Deoxyribonucleic acid amplified past the polymerase concatenation reaction. Am J Trop Med Hyg54: 647–651.

      )| simulated

    • Search Google Scholar
    • Export Citation
  • xv.↑

    Lane DJ , 1991 . 16S/23S rRNA sequencing . Stackebrandt E , Goodfellow M , eds. Nucleic Acid Techniques in Bacterial Systematics . Chichester, England : John Wiley & Sons .

      Lane DJ , 1991. 16S/23S rRNA sequencing. Stackebrandt Eastward Goodfellow M , eds. Nucleic Acid Techniques in Bacterial Systematics. Chichester, England: John Wiley & Sons.

      )| false

    • Search Google Scholar
    • Export Citation
  • 16.↑

    Corman VM et al. 2016 . Analysis optimization for molecular detection of zika virus . Balderdash World Health Organ 94 : 880 – 892 .

      Corman VM 2016. Assay optimization for molecular detection of zika virus. Bull World Health Organ94: 880–892.

      )| false

    • Search Google Scholar
    • Export Citation
  • 17.↑

    Leparc-Goffart I , Baragatti Thousand , Temmam S , Tuiskunen A , Moureau G , Charrel R , de Lamballerie Ten , 2009 . Development and validation of existent-time 1-step reverse transcription-PCR for the detection and typing of dengue viruses . J Clin Virol 45 : 61 – 66 .

      Leparc-Goffart I Baragatti M Temmam S Tuiskunen A Moureau G Charrel R de Lamballerie X , 2009. Development and validation of real-time one-step reverse transcription-PCR for the detection and typing of dengue viruses. J Clin Virol45: 61–66.

      )| false

    • Search Google Scholar
    • Consign Citation
  • eighteen.↑

    Valbuena K , 2013 . Rickettsioses: pathogenesis, immunity, and vaccine evolution . Acta Médica Costarricense 55 : 48 – 59 .

      Valbuena Yard , 2013. Rickettsioses: pathogenesis, amnesty, and vaccine development. Acta Médica Costarricense55: 48–59.

      )| faux

    • Search Google Scholar
    • Consign Citation
  • 19.↑

    De Brito T , Silva A , Abreu PAE , 2018 . Pathology and pathogenesis of human leptospirosis: a commented review . Rev Inst Med Trop Sao Paulo 60 : e23 .

      De Brito T Silva A Abreu PAE , 2018. Pathology and pathogenesis of human leptospirosis: a commented review. Rev Inst Med Trop Sao Paulothreescore: e23.

      )| simulated

    • Search Google Scholar
    • Export Commendation
  • twenty.↑

    Ruiz-Giardin JM , Martin-Diaz RM , Jaqueti-Aroca J , Garcia-Arata I , San Martin-Lopez JV , Saiz-Sanchez Buitrago Yard , 2015 . Diagnosis of bacteraemia and growth times . Int J Infect Dis 41 : 6 – 10 .

      Ruiz-Giardin JM Martin-Diaz RM Jaqueti-Aroca J Garcia-Arata I San Martin-Lopez JV Saiz-Sanchez Buitrago M , 2015. Diagnosis of bacteraemia and growth times. Int J Infect Dis41: 6–10.

      )| false

    • Search Google Scholar
    • Export Citation
  • 21.↑

    Angus DC , van der Poll T , 2013 . Severe sepsis and septic shock . N Engl J Med 369 : 2063 .

      Angus DC van der Poll T , 2013. Severe sepsis and septic shock. Due north Engl J Med369: 2063.

      )| false

    • Search Google Scholar
    • Export Citation
  • 22.↑

    Sautter RL , Bills AR , Lang DL , Ruschell G , Heiter BJ , Bourbeau PP , 2006 . Effects of delayed-entry conditions on the recovery and detection of microorganisms from BacT/Alert and BACTEC claret culture bottles . J Clin Microbiol 44 : 1245 – 1249 .

      Sautter RL Bills AR Lang DL Ruschell 1000 Heiter BJ Bourbeau PP , 2006. Effects of delayed-entry conditions on the recovery and detection of microorganisms from BacT/Alarm and BACTEC blood civilisation bottles. J Clin Microbiol44: 1245–1249.

      )| false

    • Search Google Scholar
    • Export Citation
  • 23.↑

    Harris AM et al. 2017 . Influence of antibiotics on the detection of bacteria past civilization-based and culture-independent diagnostic tests in patients hospitalized with customs-acquired pneumonia . Open Forum Infect Dis iv : ofx014 .

      Harris AM 2017. Influence of antibiotics on the detection of bacteria by culture-based and civilization-independent diagnostic tests in patients hospitalized with community-acquired pneumonia. Open Forum Infect Disfour: ofx014.

      )| false

    • Search Google Scholar
    • Export Citation
  • 24.↑

    World Wellness Organization , 2015 . WHO Launched the Outset Global Antibiotic Awareness Week Entrada in Lao People'southward Democratic Republic . .

      World Health Organization , 2015. WHO Launched the First Global Antibiotic Awareness Week Campaign in Lao People'south Democratic Democracy. Available at: https://world wide web.who.int/laos/news/feature-stories/detail/who-launched-the-starting time-global-antibiotic-awareness-week-entrada-in-lao-people-s-democratic-republic. Accessed April 5, 2020.

      )| false

    • Search Google Scholar
    • Export Citation
  • 25.↑

    Khennavong M et al. 2011 . Urine antibiotic activity in patients presenting to hospitals in Laos: implications for worsening antibiotic resistance . Am J Trop Med Hyg 85 : 295 – 302 .

      Khennavong Thousand 2011. Urine antibiotic action in patients presenting to hospitals in Lao people's democratic republic: implications for worsening antibiotic resistance. Am J Trop Med Hyg85: 295–302.

      )| false

    • Search Google Scholar
    • Export Citation
  • 26.↑

    Griffith ME , Horvath LL , Mika WV , Hawley JS , Moon JE , Hospenthal DR , Murray CK , 2006 . Viability of Leptospira in BacT/Alert MB media . Diagn Microbiol Infect Dis 54 : 263 – 266 .

      Griffith ME Horvath LL Mika WV Hawley JS Moon JE Hospenthal DR Murray CK , 2006. Viability of Leptospira in BacT/ALERT MB media. Diagn Microbiol Infect Dis54: 263–266.

      )| false

    • Search Google Scholar
    • Consign Citation

Post a Comment for "Blood Culturebased Diagnosis of Bacteraemia State of the Art"